Ireland and binepal 1998

Author: gsys

August undefined, 2024

http://www.agrijournals.ir/article_122049_84861114192f224594ee2dae3345b6b2.pdf Web472 Ebrahimi-Jam et al / Archives of Razi Institute, Vol. 76, No. 3 (2024) 471-485 1. Introduction The capripoxvirus genus, a member of the

Molecular detection of lumpy skin disease virus from clinically …

WebHadeer et al., J. of Virol.Sci., Vol.7: 41- 53, 2024 ISSN: 1685-1687 RESEARCH Correspondence: [email protected] Full list of author information is available at the end of the article Webcapripoxvirus virus (Ireland & Binepal 1998, Mangana-Vougiouka 1999, Hein et al 1999). In this study a PCR assay based on capripoxvirus P32 gene was developed to identify capripoxvirus DNA in cell culture and biopsy samples by detecting 390 bp band in agar gel electrophoresis. MATERIALS AND METHODS Viruses and cells. 1. The capripoxvirus strains ear aches essential oil remedy

Molecular epidemiology of lumpy skin disease outbreak in

WebThe PCR primers were developed from the viral attachment protein encoding gene and have the following sequences: forward primer 5'-d TTTCCTGATTTTTCTTACTAT3' and reverse primer 5'-d AAATTATATACGTAAATAAC 3’ (Ireland and Binepal 1998). The size of the amplicon was 192 bp (Ireland and Binepal, 1998). A Ahmed and Zaher 253 WebIreland, D. C. & Y. S. Binepal, 1998. Im- proved detection of capripoxvirus in bi- opsy samples by PCR. Journal of Vi- rological Methods, 74, 1–7. Lamien, C. E., C. Le Goff, R. Silber, D. B. Wallace, V. Gulyaz, E.Tuppurainen, H. Madani, P. Caufour, T. Adam, M. El Har- rak, A. G. Luckins, E. Albina & A. Diallo, 2011a. WebMar 25, 2024 · The samples were processed to make a suspension ( Bora et al. 2024) and subjected to standard virologic and molecular diagnosis by counter immunoelectrophoresis ( Sharma et al. 1988 ), PCR ( Ireland and Binepal 1998 ), and PCR-restriction fragment length polymorphism (PCR-RFLP; Hosamani et al. 2004 ). earache sharp intermittent pains

Development and validation of three Capripoxvirus real …

Ireland and binepal 1998

WebNov 21, 2005 · DC Ireland YS Binepal (1998) ArticleTitle Improved detection of capripoxvirus in biopsy samples by PCR. J Virol Methods 74 1–7 Occurrence Handle 10.1016/S0166-0934(98)00035-4 Occurrence Handle 1:CAS:528:DyaK1cXltFWqsbo%3D Occurrence Handle … WebApr 6, 2005 · ing, Hammond & Chand 1994; Carn 1995; Ireland & Binepal 1998; Heine, Stevens, Foord & Boyle 1999). The disease is of economic importance because of …

Did you know?

WebJan 17, 2009 · The loss of these bright minds, one of Ireland's few precious assets at the time, was popularly referred to as the 'brain drain'. In 1980, around 8pc of college … WebApr 22, 2024 · Ireland DC, Binepal YS (1998) Improved detection of Capripoxvirus in biopsy samples by PCR. J Virol Methods 74:1–7. Article CAS Google Scholar Kumar S, Stecher G, …

WebSep 1, 1998 · Journal of Virological Methods Volume 74, Issue 1, September 1998, Pages 1-7 Improved detection of capripoxvirus in biopsy samples by PCR D.C Ireland a , Y.S … WebMar 1, 2016 · Ireland, Binepal, 1998 D.C. Ireland, Y.S. Binepal Improved detection of capripoxvirus in biopsy samples by PCR Journal of Virological Methods, 74 ( 1998), pp. 1 - …

WebNov 10, 2024 · TAA-ATT-ATA-TAC-GTA-AAT-AAC-3’ primers were used (Ireland and Binepal 1998). The conditions for DNA amplification in a Thermal Cycler (Eppendorf Mastercycler) were as follows: 95°C for 2 min, 95°C for 45 s, 50°C for 50 s, 72°C for 1 … Webimmunoassays ( Ireland and Binepal, 1998). In Egypt, LSDV was first isolated and identified from cattle during two outbreaks in Suez and Ismalia governorates on 1989 ( House et al., …

WebA range of conventional agarose-gel-based polymerase chain reaction (PCR) assays (Ireland and Binepal, 1998; Heine et al., 1999; Markoulatos et al., 2000; Tuppurainen et al., 2005; Zheng et al., 2007 ), or real-time PCR assays (Balinsky et al., 2008; Bowden et al., 2008; Stubbs et al., 2012) are used in diagnostic laboratories.

Web72 oC for 5 min (Ireland & Binepal, 1998). The reaction mixture (20 μL) con-tained 1× PCR buffer, 1.5 mM of MgCl2, 0.2 mM of dNTPs, 0.5 pmol/μL of each primer, 1 unit of Taq DNA polymerase and 5 μL of template DNA. 160 BJVM, 16, No … earaches from swimmingWebOct 31, 2009 · Ireland, D.C. and Binepal, Y.S., 1998. Improved detection of capripoxvirus in biopsy samples by PCR. Journal of Virological Methods, 74, 1-7. Article CAS PubMed … ear aches icd 10WebMar 13, 2024 · Using routine laboratory tests Capripoxviruses cannot be distinguished (Kitching, 1986; Davies and Otema, 1981). Polymerase chain reaction (PCR) offers a rapid and sensitive diagnostic technique for capripoxvirus genome detection (Ireland and Binepal, 1998; Heine et al., 1999). earache significadoWebOct 31, 2009 · Polymerase chain reaction (PCR)-based assays have been developed for the detection of Capripoxvirus nucleic acid in a variety of clinical samples (Ireland and Binepal 1998; OIE 2008). The objective of this study was to determine the most sensitive laboratory technique, and the most suitable clinical sample could be used for the diagnosis of LSDV. earache shoulder pain neck painJun 17, 2016 · earache sign of omicronWebJan 1, 2006 · Several PCR methods have been developed for the detection of CaPVs (Ireland and Binepal, 1998;Heine et al., 1999;Mangana-Vougiouka et al., 1999Markoulatos et al., … ear ache sign covidWebJul 11, 2013 · Several PCR methods have been developed for the detection of CaPVs (Ireland and Binepal, 1998;Heine et al., 1999;Mangana-Vougiouka et al., 1999Markoulatos … csrss priority